View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_66 (Length: 252)
Name: NF0760_low_66
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0760_low_66 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 15 - 127
Target Start/End: Original strand, 40225297 - 40225409
Alignment:
Q |
15 |
gagatgtcgggaagaacaatgacgttggttcgaaatctggctttagaattgtcgcaggtgaaaacagaggtttgttgttgtttttagagagaggaaaaag |
114 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40225297 |
gagatgtcgggaagaacaatgatgttggttcgaaatctggctttagaattgtcgcaggtgaaaacagaggtttgttgttgtttttagagagaggaaaaag |
40225396 |
T |
 |
Q |
115 |
ggtttaggcttat |
127 |
Q |
|
|
||||||||||||| |
|
|
T |
40225397 |
ggtttaggcttat |
40225409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 18106925 - 18106987
Alignment:
Q |
15 |
gagatgtcgggaagaacaatgacgttggttcgaaatctggctttagaattgtcgcaggtgaaa |
77 |
Q |
|
|
|||||||||||||||||||||| ||||| |||||||||| ||||| ||||||||||||||||| |
|
|
T |
18106925 |
gagatgtcgggaagaacaatgatgttgggtcgaaatctgtctttaaaattgtcgcaggtgaaa |
18106987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3710 times since January 2019
Visitors: 4818