View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_70 (Length: 251)
Name: NF0760_low_70
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0760_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 2 - 230
Target Start/End: Complemental strand, 24474446 - 24474218
Alignment:
Q |
2 |
cattttctctaattatgcataaattggtttttataaaaaatcacgcacagtcaatgctcaagcgatcgatgcggcttccggtgccttaatcccttaccag |
101 |
Q |
|
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24474446 |
cattttctcaaattatgcataaattggttttcataaaaaatcacgcacagtcaatgctcaagcgatcgatgcggcttccggtgccttaatcccttaccag |
24474347 |
T |
 |
Q |
102 |
gttcttccgtattctctttcttcttacatcccatcttaggctaattgaataaatttgaacttatgattgtcaatgtaaatgattttctatttttgttact |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24474346 |
gttcttccgtattctctttcttcttacatcccatcttaggctaattgaataaatttgaacttatgattgtcaatgtaaatgattttctatttttgttact |
24474247 |
T |
 |
Q |
202 |
ttcatcttctctacaattatttgatgatg |
230 |
Q |
|
|
|||||||||||||||||||||| |||||| |
|
|
T |
24474246 |
ttcatcttctctacaattattttatgatg |
24474218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 75 - 201
Target Start/End: Original strand, 24417720 - 24417845
Alignment:
Q |
75 |
gcttccggtgccttaatcccttaccaggttcttccgtattctctttcttcttacatcccatcttaggctaattgaataaatttgaacttatgattgtcaa |
174 |
Q |
|
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
T |
24417720 |
gcttccagtgccttaatcccttaccaggttct-ccgtattctctttcttcttacatcccatcttaggctacttgaataaatttgaacttatgtttgtcaa |
24417818 |
T |
 |
Q |
175 |
tgtaaatgattttctatttttgttact |
201 |
Q |
|
|
||||| ||||||| ||||||||||||| |
|
|
T |
24417819 |
tgtaactgattttatatttttgttact |
24417845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University