View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_71 (Length: 251)
Name: NF0760_low_71
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0760_low_71 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 24 - 228
Target Start/End: Original strand, 12223103 - 12223311
Alignment:
| Q |
24 |
tcatcatggaaatcttgactaatcgtctgttt-atgtttattgttgtataattgnnnnnnn----caataaggttgtgcaaaaagtttaaagcaattggt |
118 |
Q |
| |
|
||||||| ||||||||||||||| |||||||| |||||||||||||||| |||| |||||||||| ||||| |||||||||||||||||| |
|
|
| T |
12223103 |
tcatcatagaaatcttgactaattgtctgttttatgtttattgttgtatcattgaaaaaaaaaaacaataaggttatgcaagaagtttaaagcaattggt |
12223202 |
T |
|
| Q |
119 |
ttccaaattcaaaagcctaccccaaacttataagtcaataatttccttaaaaattgagatattcccttgatatactactttagtaattttgaagtatcta |
218 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12223203 |
ttccaaattcaaa-gcctaccccaaacttataagtcaataatttctttaaaaattgagatattcccttgatatattactttagtaattttgaagtatctc |
12223301 |
T |
|
| Q |
219 |
aattatctaa |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
12223302 |
aattatctaa |
12223311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3122 times since January 2019
Visitors: 4805