View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_72 (Length: 250)
Name: NF0760_low_72
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0760_low_72 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 44072470 - 44072250
Alignment:
| Q |
1 |
cctgtgaatctaagggaaaaattccacgctgacaatccgtgctttcctctgttaacaaataaacgaaagccttgggatcccacaaaacgcnnnnnnntat |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||| || ||||||| || |||||||| || |||||||| ||||||||||| ||| |
|
|
| T |
44072470 |
cctgtgaatctaagggagaaattccacgctggcaatccgtgccttactctgttgaccaataaacgcaaagcttgggataccacaaaacgcaaaaaaatat |
44072371 |
T |
|
| Q |
101 |
ttggttttcccgccaatggaagtgccaggctggcgatccgtgccttaccctctcaaccaataagcgcaaagcttggattcctatataacaacacttcatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44072370 |
ttggttttcccgccaatggaagtgccacgctggcgatccgtgccttaccctctcaaccaataagcgcaaagcttggattcctatataacaacacttcatc |
44072271 |
T |
|
| Q |
201 |
gtcttcacaattcacagtctt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44072270 |
gtcttcacaattcacagtctt |
44072250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2847 times since January 2019
Visitors: 4801