View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_73 (Length: 250)
Name: NF0760_low_73
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0760_low_73 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 25 - 250
Target Start/End: Complemental strand, 43875011 - 43874786
Alignment:
| Q |
25 |
catcaactaagagcaattccaatgtgggttcttaggagttcttagagggttcaccattagagtactttgcatggcattccgggtggaaaatatgttctta |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43875011 |
catcaactaagagcaattccaatgtgggttcttaggagttcttagagggttcaccattagagtactttgcatggcattccgggtggaaaataggttctta |
43874912 |
T |
|
| Q |
125 |
cagaagtacacactcttaccaaaatttaagaataannnnnnnnnngagaaagtaatggccaagtatatactacatgtaaaagccgatctctcttcattct |
224 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43874911 |
cagaagcacacactcttaccaaaatttaagaataattttttttttgagaaagtaatggccaagtatatactacatgtaaaagccgatctctcttcattct |
43874812 |
T |
|
| Q |
225 |
actcttctgcttagctggtttcaact |
250 |
Q |
| |
|
|||||||| ||||||||||||||||| |
|
|
| T |
43874811 |
actcttctccttagctggtttcaact |
43874786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2640 times since January 2019
Visitors: 4796