View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_75 (Length: 248)
Name: NF0760_low_75
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0760_low_75 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 33789168 - 33789415
Alignment:
Q |
1 |
ttctgtaatatcggactctatttgtattatacaaagtctaggttaataataaactttgtctttnnnnnnnntaaacatcagagttgagactaattgaata |
100 |
Q |
|
|
|||||||||||||| |||||||||| |||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
T |
33789168 |
ttctgtaatatcggtctctatttgtcttatacaaagactaggtttttaataaactttgtcttttaaaaaaataaacatcagagttgagactaattaaata |
33789267 |
T |
 |
Q |
101 |
acttaccttagtttcataaccttcaggaagttgcctgatgaaattatgtgcattagcagcagaagaagcagcaacaatttcatccatagtagcatcattt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33789268 |
acttaccttagtttcataaccttcaggaagttgcctaatgaaattatgagcattggcagcagaagaagcagcaacaatttcatccatagtagcatcattt |
33789367 |
T |
 |
Q |
201 |
ttcccaaacataatattttccttaatagatgtcccaaacatagcatgt |
248 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
33789368 |
ttcccaaacataatattttccttaatagatgttccaaacatagcatgt |
33789415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5013 times since January 2019
Visitors: 4844