View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_79 (Length: 228)
Name: NF0760_low_79
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0760_low_79 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 12 - 228
Target Start/End: Original strand, 1587276 - 1587492
Alignment:
| Q |
12 |
aagaaaagtgcggcggagaaagcgaaagcagataggaaattaaagaagaaagagtgagtaggtggggatagtaagnnnnnnnnnnnngggagggaaagaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1587276 |
aagaaaagtgcggcggagaaagcgaaagcagataggaaattaaagaagaaagagtgagtaggtggggatagtaagaaaaagaaaaaagggagggaaagaa |
1587375 |
T |
|
| Q |
112 |
ggaggattaaacggaaacgatggcggagacgacggagtgcggcggaggagacggcggcgagtgaatgaaaatgaaaagatggnnnnnnngtgggaaattg |
211 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
1587376 |
ggaggattaaacgggaacgatggcggagacgacggagtgcggcggaggagacggcggagagagaatgaaaatgaaaagatgattttttagtggaaaattg |
1587475 |
T |
|
| Q |
212 |
tgggaaattgaaattga |
228 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1587476 |
tgggaaattgaaattga |
1587492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2938 times since January 2019
Visitors: 4805