View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0760_low_83 (Length: 217)

Name: NF0760_low_83
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0760_low_83
NF0760_low_83
[»] chr4 (1 HSPs)
chr4 (1-203)||(37677294-37677496)
[»] chr8 (1 HSPs)
chr8 (14-54)||(41444945-41444985)


Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 37677496 - 37677294
Alignment:
1 aagcatgacaacatatattgaatgcaattttagcaaaatgcgaagcatttctaatttggcaaaagtgtgttcatattcccataatccacccttaattcag 100  Q
    |||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37677496 aagcatgacaacatatatggaatgcaattttagcaaaaggtgaagcatttctaatttggcaaaagtgtgttcatattcccataatccacccttaattcag 37677397  T
101 attatctgnnnnnnncccccttccgcatagacttacaaaggcatacttgtggttaccagggattattcatttttaagttagatgcttagttcttgatgat 200  Q
    ||||||||        |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37677396 attatctgttttttttccccttccgcttagacttacaaaggcatacttgtggttaccagggattattcatttttaagttagatgcttagttcttgatgat 37677297  T
201 gtc 203  Q
    |||    
37677296 gtc 37677294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 41444985 - 41444945
Alignment:
14 tatattgaatgcaattttagcaaaatgcgaagcatttctaa 54  Q
    ||||| ||||| ||||||||||||| |||||||||||||||    
41444985 tatatggaatgtaattttagcaaaaggcgaagcatttctaa 41444945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2733 times since January 2019
Visitors: 4801