View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0760_low_83 (Length: 217)
Name: NF0760_low_83
Description: NF0760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0760_low_83 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 37677496 - 37677294
Alignment:
| Q |
1 |
aagcatgacaacatatattgaatgcaattttagcaaaatgcgaagcatttctaatttggcaaaagtgtgttcatattcccataatccacccttaattcag |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37677496 |
aagcatgacaacatatatggaatgcaattttagcaaaaggtgaagcatttctaatttggcaaaagtgtgttcatattcccataatccacccttaattcag |
37677397 |
T |
 |
| Q |
101 |
attatctgnnnnnnncccccttccgcatagacttacaaaggcatacttgtggttaccagggattattcatttttaagttagatgcttagttcttgatgat |
200 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37677396 |
attatctgttttttttccccttccgcttagacttacaaaggcatacttgtggttaccagggattattcatttttaagttagatgcttagttcttgatgat |
37677297 |
T |
 |
| Q |
201 |
gtc |
203 |
Q |
| |
|
||| |
|
|
| T |
37677296 |
gtc |
37677294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 41444985 - 41444945
Alignment:
| Q |
14 |
tatattgaatgcaattttagcaaaatgcgaagcatttctaa |
54 |
Q |
| |
|
||||| ||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
41444985 |
tatatggaatgtaattttagcaaaaggcgaagcatttctaa |
41444945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University