View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0761_high_14 (Length: 203)
Name: NF0761_high_14
Description: NF0761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0761_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 23 - 129
Target Start/End: Complemental strand, 44281650 - 44281544
Alignment:
| Q |
23 |
tgttactttatttttgagaattttttgaacaagatggcaaaagaacaaaaaccatttctcttcttagttcttgcttgtaaccaagctcattgagtctctt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44281650 |
tgttactttatttttgagaattttttgatcaagatggcaaaagaacaaaaaccatttctcttcttagttcttgcttgtaaccaagctcattgagtctctt |
44281551 |
T |
 |
| Q |
123 |
ctctgct |
129 |
Q |
| |
|
||||||| |
|
|
| T |
44281550 |
ctctgct |
44281544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 52 - 129
Target Start/End: Complemental strand, 41367800 - 41367723
Alignment:
| Q |
52 |
caagatggcaaaagaacaaaaaccatttctcttcttagttcttgcttgtaaccaagctcattgagtctcttctctgct |
129 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41367800 |
caaggtggcaatagaacaaaaaccatttctcttcttagttcttgcttgtaaccaagctcattgattctcttctctgct |
41367723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University