View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0761_high_9 (Length: 336)
Name: NF0761_high_9
Description: NF0761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0761_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 26 - 322
Target Start/End: Complemental strand, 30964939 - 30964642
Alignment:
Q |
26 |
ataaacctcaataactaagtcttcatgtttgccttaatttgagctgcaataaacctcaataactaagtcttcatgtttgccttaatttgagctggataag |
125 |
Q |
|
|
||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
30964939 |
ataaacctcaacaatcaagtattcatgtttgccttaatttgagctgcaataaacctcaataactaagtattcatgtttgccttaatttgagctggataag |
30964840 |
T |
 |
Q |
126 |
caaggaaacacacagctttgttttattctcttgacattgcatttaacacaaacatgcttcttcttgaggttgaattagttcaatcc-nnnnnnnggacga |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
30964839 |
caaggaaacacacagctttgttttattctcttgacattgcatttaacacaaacatgcttcttcttgaggttgaattagttcaatcctttttttgggacgg |
30964740 |
T |
 |
Q |
225 |
gcatgtcctttgaagtgtgaatatgtttttctatttaaatttcccatcaggtaatattgtttgcttgcagaagatgaggatgatgatgatgtccatct |
322 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
30964739 |
gcatgtcctttgaagtgtgaatatgtttttctatttaaatttcccatcaggtaatattgtttgcttgcagaagatgaggatgatgatgatgttcatct |
30964642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 30964916 - 30964846
Alignment:
Q |
1 |
catgtttgccttaatttgagctgcaataaacctcaataactaagtcttcatgtttgccttaatttgagctg |
71 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
30964916 |
catgtttgccttaatttgagctgcaataaacctcaataactaagtattcatgtttgccttaatttgagctg |
30964846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University