View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0761_low_16 (Length: 318)
Name: NF0761_low_16
Description: NF0761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0761_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 48345222 - 48345446
Alignment:
| Q |
1 |
cgttcttgtttgagtaaaaattcatctaaatcaagagataaattacataatggtgataaaagaacggtccgtttttacccggtgagtgtgattgttgatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48345222 |
cgttcttgtttgagtaaaaattcatctaaatcaagagataaattacacaatggtgataaaagaacggtccgtttttacccggtgagtgtgattgttgatg |
48345321 |
T |
|
| Q |
101 |
aagataatcgagcttgtggtcataaatatttgaataaaggagttacaaagaagaatgaagaagttgtggacaagagtaagaaagaggaggaagttgctag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48345322 |
aagataatcgagcttgtggtcataaatatttgaataaaggagttacaaagaagaatgaagaagttgtggacaagagtaagaaagaggaggaagttgctag |
48345421 |
T |
|
| Q |
201 |
agaatttttaacagagtaccatctt |
225 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
48345422 |
agaatttttaagagagtaccatctt |
48345446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5100 times since January 2019
Visitors: 4845