View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0761_low_17 (Length: 287)
Name: NF0761_low_17
Description: NF0761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0761_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 31587174 - 31587112
Alignment:
Q |
1 |
aagactggtgggttgttttgagggaagagaaagtagtgagagaaggaaatgagggttttttgg |
63 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31587174 |
aagactggtgggttgttttgagggaagagaaagtagtgagagaaggaaatgagggttttttgg |
31587112 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University