View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0761_low_22 (Length: 251)
Name: NF0761_low_22
Description: NF0761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0761_low_22 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 47625697 - 47625476
Alignment:
| Q |
30 |
gaaacatcgtgtccactatgagccattaagatgaccgaaaatggagtctcagatttaggaagttatcatataaa-ttaacttatcttctattctctttgc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47625697 |
gaaacatcgtgtccactatgagccattaagatgaccgaaaatggagtctcagatttaggaagttatcatataaatttaacttatcttctattctctttgc |
47625598 |
T |
 |
| Q |
129 |
cttttttatcaacatannnnnnnngtcttaaaatttattacagagagaaccaaagatcatcatttgtattattattcatcaacaatgccactgactaact |
228 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47625597 |
cttttttatcaaaata-tttttttgtcttaaaatttattacagagagaaccaaagatcatcatttgtattattattcatcaacaatgccactgactaact |
47625499 |
T |
 |
| Q |
229 |
aaaaatagacttttatgcatgcc |
251 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
47625498 |
aaaaatagacttttatgcatgcc |
47625476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University