View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0762_low_7 (Length: 301)
Name: NF0762_low_7
Description: NF0762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0762_low_7 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 19 - 301
Target Start/End: Complemental strand, 9700434 - 9700152
Alignment:
| Q |
19 |
cctgtgaaaatgaagtgattgacgcaacatccccactccaattaaatcccttatcttgcgaactttttggcatacggccttctaaataatctgacaatat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9700434 |
cctgtgaaaatgaagtgattgacgcaacatccccactccaattaaatcccttatcttgcgaactttttggcatacggccttctaaataatctgacaatat |
9700335 |
T |
 |
| Q |
119 |
gatacttggaagaccattccttttggtgatctgtctctttttaggatcataattagaaatcaggcattcaacaaaatgcttaacagctgcataagcacgt |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9700334 |
gatacttggaagaccattccttctggtgatctgtctctttttaggatcataattagaaatcaggcattcaacaaaatgcttaacagctgcataagcacgt |
9700235 |
T |
 |
| Q |
219 |
ttccagttgcctgaaaaatataaaaataacaatgcggcgtgaaaaaatgatataattcccatcacatgcttgagtaagggcct |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9700234 |
ttccagttgcctgaaaaatataaaaataacaatgcggcgtgaaaaaatgatataattcccatcacatgcttgagtaagggcct |
9700152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University