View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0762_low_7 (Length: 301)

Name: NF0762_low_7
Description: NF0762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0762_low_7
NF0762_low_7
[»] chr8 (1 HSPs)
chr8 (19-301)||(9700152-9700434)


Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 19 - 301
Target Start/End: Complemental strand, 9700434 - 9700152
Alignment:
19 cctgtgaaaatgaagtgattgacgcaacatccccactccaattaaatcccttatcttgcgaactttttggcatacggccttctaaataatctgacaatat 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9700434 cctgtgaaaatgaagtgattgacgcaacatccccactccaattaaatcccttatcttgcgaactttttggcatacggccttctaaataatctgacaatat 9700335  T
119 gatacttggaagaccattccttttggtgatctgtctctttttaggatcataattagaaatcaggcattcaacaaaatgcttaacagctgcataagcacgt 218  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9700334 gatacttggaagaccattccttctggtgatctgtctctttttaggatcataattagaaatcaggcattcaacaaaatgcttaacagctgcataagcacgt 9700235  T
219 ttccagttgcctgaaaaatataaaaataacaatgcggcgtgaaaaaatgatataattcccatcacatgcttgagtaagggcct 301  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9700234 ttccagttgcctgaaaaatataaaaataacaatgcggcgtgaaaaaatgatataattcccatcacatgcttgagtaagggcct 9700152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3377 times since January 2019
Visitors: 4812