View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0762_low_8 (Length: 300)
Name: NF0762_low_8
Description: NF0762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0762_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 70 - 250
Target Start/End: Original strand, 45687925 - 45688100
Alignment:
| Q |
70 |
acatcatcagcaaataggaggagggagatgggaagggcattccttgagaatttgaataggatgtcaattaccgctattggcagtttcacaaatagagtta |
169 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45687925 |
acatcatcaggaaataggaggagggagatgtgaagggcattccttgaga-tttgaataggatgtcaattaccgctattggcagtttcacaaatagagata |
45688023 |
T |
 |
| Q |
170 |
aagagttttcctatatatacaaaggatgaagagatataaacagagcatatttccttgcctaatgcatgccatgagtcatct |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45688024 |
aagagttttcctata----caaaggatgaagagatataaacagagcatatttccttgcctaatgcatgccatgagtcatct |
45688100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University