View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0763-Insertion-3 (Length: 234)
Name: NF0763-Insertion-3
Description: NF0763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0763-Insertion-3 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 8 - 234
Target Start/End: Original strand, 8152492 - 8152718
Alignment:
| Q |
8 |
agctctgctagggttagtttcccttcaccaacgatgttgagttaacttcggccgggggttcttccttctgcaagaggggaatgctcttgctttatttagc |
107 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8152492 |
agctctgctagggttagttccccttcaccaacgatgttgagttaacttcgggcgggggttcttccttctgcaagaggggaatgctcttgctttatttagc |
8152591 |
T |
|
| Q |
108 |
agcctcatctcctcattttcttcaaccatggatgttccacaatttaatcctttcaatggtaccacccacacatcctcagtcttgacgaccaccatcggaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
8152592 |
agcctcatctcctcattttcttcaaccatggatgttccacaatttaatcctttcaatggtaccacccacacatcctcagtcttgacgaccacaacaaaaa |
8152691 |
T |
|
| Q |
208 |
ccccctcttttgtagctcttgttttca |
234 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8152692 |
ccccctcttttgtagctcttgttttca |
8152718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2656 times since January 2019
Visitors: 4796