View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0763-Insertion-5 (Length: 172)
Name: NF0763-Insertion-5
Description: NF0763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0763-Insertion-5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 75 - 108
Target Start/End: Original strand, 30135687 - 30135720
Alignment:
Q |
75 |
caactgccttaaacaaactcttctcaaaatgaaa |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
30135687 |
caactgccttaaacaaactcttctcaaaatgaaa |
30135720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2612 times since January 2019
Visitors: 4796