View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0763-Insertion-5 (Length: 172)

Name: NF0763-Insertion-5
Description: NF0763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0763-Insertion-5
NF0763-Insertion-5
[»] chr5 (1 HSPs)
chr5 (75-108)||(30135687-30135720)


Alignment Details
Target: chr5 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 75 - 108
Target Start/End: Original strand, 30135687 - 30135720
Alignment:
75 caactgccttaaacaaactcttctcaaaatgaaa 108  Q
    ||||||||||||||||||||||||||||||||||    
30135687 caactgccttaaacaaactcttctcaaaatgaaa 30135720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2612 times since January 2019
Visitors: 4796