View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0763-Insertion-6 (Length: 145)
Name: NF0763-Insertion-6
Description: NF0763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0763-Insertion-6 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 4e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 4e-64
Query Start/End: Original strand, 10 - 145
Target Start/End: Original strand, 35565894 - 35566029
Alignment:
Q |
10 |
tagtacccaaaataatgagataaacatctaatttataggcaaaacgtgtaattcaaattaccagctctggtatttaacatgattcaaattactatttcca |
109 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
35565894 |
tagtaccctaaataatgagataaacatctaatttataggcaaaacgtgtaattcaaattaccaactctggtatttaacatgattcaaattactatttcca |
35565993 |
T |
 |
Q |
110 |
acacgccattccacttctacatgcatcctccttaag |
145 |
Q |
|
|
||||||||||| |||||||||||||||||||||||| |
|
|
T |
35565994 |
acacgccattctacttctacatgcatcctccttaag |
35566029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University