View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0763_high_7 (Length: 328)
Name: NF0763_high_7
Description: NF0763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0763_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 1e-41; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 208 - 306
Target Start/End: Original strand, 33856656 - 33856754
Alignment:
| Q |
208 |
acaatgcagattgatagttatttttgttgtatgtcttaaagctattctacatcattcattttctgaataaagatgaagctctccacaaaccatgatgat |
306 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33856656 |
acaatgcagattgatggttttttttgttgtatgtcttaaagctattctacatcattcattttatgaataaagatgaagctctccacaaaccatgatgat |
33856754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 208 - 306
Target Start/End: Complemental strand, 33924267 - 33924169
Alignment:
| Q |
208 |
acaatgcagattgatagttatttttgttgtatgtcttaaagctattctacatcattcattttctgaataaagatgaagctctccacaaaccatgatgat |
306 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33924267 |
acaatgcagattgatggttttttttgttgtatgtcttaaagctattctacatcattcattttatgaataaagatgaagctctccacaaaccatgatgat |
33924169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 34 - 96
Target Start/End: Complemental strand, 573698 - 573636
Alignment:
| Q |
34 |
caaagggttttcagatttccataacctgaaactattttatctgtggtatgtggaactttcttg |
96 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
573698 |
caaagagttttcagatttccataacctaaaactattttatctgtggtatgtggaactttcttg |
573636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 163 - 207
Target Start/End: Original strand, 33856592 - 33856636
Alignment:
| Q |
163 |
atgcaccgactatttttacgctgacatggccaaatcacaaagata |
207 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
33856592 |
atgcaccgactagttttacactgacatggccaaatcacaaagata |
33856636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 163 - 207
Target Start/End: Complemental strand, 33924331 - 33924287
Alignment:
| Q |
163 |
atgcaccgactatttttacgctgacatggccaaatcacaaagata |
207 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
33924331 |
atgcaccgactagttttacactgacatggccaaatcacaaagata |
33924287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University