View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0763_low_14 (Length: 317)
Name: NF0763_low_14
Description: NF0763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0763_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 31955443 - 31955688
Alignment:
| Q |
1 |
ctaaatctttcgatacatctccaattgatctaatatgtgcagaagctattattgcttgatataggtgtctattacctcattcttgcatctacaaaccata |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31955443 |
ctaaatctttcgatacatctccaaatgatctaatatgtgcagaagctattattgcttgatataggtgtctattacctcattcttgcatctacaaaccata |
31955542 |
T |
 |
| Q |
101 |
tactttgagttatcagaacctggtttcgtaataataatggagtattcc---------------aacaggagctaatcttttatagtatcaaatcttcgtg |
185 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31955543 |
tactttgagttataagaacctggtttcgtaataataatggagtattcctcgatatatgtccataacaggagctaatcttttatagtatcaaatcttcgtg |
31955642 |
T |
 |
| Q |
186 |
cccaactacttttggctaaagaaggagctaaccacatgatgatgtc |
231 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31955643 |
cccaactacttttggctgaagaaggagctaaccacatgatgatgtc |
31955688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University