View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0763_low_15 (Length: 316)
Name: NF0763_low_15
Description: NF0763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0763_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 126 - 219
Target Start/End: Original strand, 4133979 - 4134072
Alignment:
Q |
126 |
taactttttaggttttattgtttaaaaattagaaccctcaaaattattgatttttaattgcaatttccatgttttattattttaaggtatggat |
219 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
4133979 |
taactttttaggttttattgtttaaaaattagaaccctcaaaattattgatttttaattgcaatttccatgttttattattgtaaggtatggat |
4134072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4613 times since January 2019
Visitors: 4836