View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0763_low_15 (Length: 316)

Name: NF0763_low_15
Description: NF0763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0763_low_15
NF0763_low_15
[»] chr5 (1 HSPs)
chr5 (126-219)||(4133979-4134072)


Alignment Details
Target: chr5 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 126 - 219
Target Start/End: Original strand, 4133979 - 4134072
Alignment:
126 taactttttaggttttattgtttaaaaattagaaccctcaaaattattgatttttaattgcaatttccatgttttattattttaaggtatggat 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
4133979 taactttttaggttttattgtttaaaaattagaaccctcaaaattattgatttttaattgcaatttccatgttttattattgtaaggtatggat 4134072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4613 times since January 2019
Visitors: 4836