View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0763_low_20 (Length: 274)
Name: NF0763_low_20
Description: NF0763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0763_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 12 - 258
Target Start/End: Original strand, 41468303 - 41468549
Alignment:
| Q |
12 |
cagaacctgtgtgtcccgagaaattctgtttgtgtgcagttgacttttcatcaggattggaacttgcatcgtccagaaaaatctcttgaaactgatcaaa |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468303 |
cagaacctgtatgtcccgagaaattctgtttgtgtgcagttgacttttcatcaggattggaacttgcatcgtccagaaaaatctcttgaaactgatcaaa |
41468402 |
T |
|
| Q |
112 |
tcttacaacctctatttctccactaaaaaatccatatacgacagcataaggtgtaaagaggttctcagcaataatcatggaagaagatactatcttcccc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468403 |
tcttacaacctctatttctccactaaaaaatccatatacgacagcataaggtgtaaagaggttctcagcaataatcatggaagaagatactatcttcccc |
41468502 |
T |
|
| Q |
212 |
ttgtaaggataataattacttatgcccttctcattgatgatgtccat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41468503 |
ttgtaaggataataattacttatgcccttctcatttatgatgtccat |
41468549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5146 times since January 2019
Visitors: 4845