View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0763_low_24 (Length: 213)
Name: NF0763_low_24
Description: NF0763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0763_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 6359158 - 6359271
Alignment:
| Q |
1 |
aggattgagaaactgcaaatcaattgatgcaaacacgagagacattttgaatttaagctcgtccttgtaattctctctatctactactgttattatttcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6359158 |
aggattgagaaactgcaaatcaattgatgcaaacacgagagacgttttgaatttaagctcgtccttgtaattctctctatttactactgttattatttcg |
6359257 |
T |
|
| Q |
101 |
ttattaaatatatt |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6359258 |
ttattaaatatatt |
6359271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3736 times since January 2019
Visitors: 4818