View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0764_low_18 (Length: 276)
Name: NF0764_low_18
Description: NF0764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0764_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 22 - 256
Target Start/End: Complemental strand, 303850 - 303602
Alignment:
Q |
22 |
catcatctgttggtctttctgacacttcctcacacgtttctctagtttttctgcaaattaacnnnnnnn--------------tgttcatattcctagct |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
303850 |
catcatctgttggtctttctgacacttcctcacacgtttctctagtttttctgcaaattaaccatgatcaataaataaaaaaatgttcatattcctagct |
303751 |
T |
 |
Q |
108 |
agcaaacaattaacatgattgtttttaatgattagtaccttcttttgtgagatcctctagcaccaggggtggaattagtcttgcaactatcttgagagtc |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
303750 |
agcaaacaattaacatgattgtttttaatgattagtaccttcttttgtgagatcctctagcaccaggggtggaattagtcttgcaactatcttgagagtc |
303651 |
T |
 |
Q |
208 |
ctcttcagatttaatggttaaggaaaagtcttgttccctttgatgatgt |
256 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
303650 |
ctcttcagatttaatggttaaggaaaagttttgttccctttgatgatgt |
303602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University