View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0764_low_22 (Length: 251)
Name: NF0764_low_22
Description: NF0764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0764_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 34555674 - 34555911
Alignment:
| Q |
1 |
cttgatttttcctcctagaacataaacttgtcaacccgtggttctataaagcactaacgcagacacgacacgacacaaacacgctatgttgacaccacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
34555674 |
cttgatttttcctcctagaacataaacttgacaacccgtggttctataaagcactaacaca-----gacacgacacaaacacgctatgttgacaccacaa |
34555768 |
T |
|
| Q |
101 |
attaaatgtaaccacaagtgtcttggcatccaagaatattgcttgggaagctaactggttttgatattttccatcactttcttccgctggatagcataag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34555769 |
attaaatgtaaccacaagtgtcttggcatccaagaatattgcttgggaagctaactggttttgatattttccatcactttcttccgctggatagcataag |
34555868 |
T |
|
| Q |
201 |
ttactcaaagcatgtatggtttacaacatgccaattctgtgat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34555869 |
ttactcaaagcatgtatggtttacaacatgccaattctgtgat |
34555911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3309 times since January 2019
Visitors: 4812