View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0764_low_27 (Length: 204)

Name: NF0764_low_27
Description: NF0764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0764_low_27
NF0764_low_27
[»] chr8 (1 HSPs)
chr8 (1-124)||(34222346-34222469)


Alignment Details
Target: chr8 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 34222469 - 34222346
Alignment:
1 gaccggaatgcatggacccaagaaatggatgttcgttcatcgaacttctagtagcaactagcaacaactactttgtctaatcttccccaccaatccgtaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34222469 gaccggaatgcatggacccaagaaatggatgttcgttcatcgaacttctagtagcaactagcaacaactactttgtctaatcttccccaccaatccgtaa 34222370  T
101 tttgtgtcgctacattattttcat 124  Q
    ||||||||||||||||||||||||    
34222369 tttgtgtcgctacattattttcat 34222346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University