View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0764_low_29 (Length: 204)
Name: NF0764_low_29
Description: NF0764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0764_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 34222469 - 34222346
Alignment:
| Q |
1 |
gaccggaatgcatggacccaagaaatggatgttcgttcatcgaacttctagtagcaactagcaacaactactttgtctaatcttccccaccaatccgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34222469 |
gaccggaatgcatggacccaagaaatggatgttcgttcatcgaacttctagtagcaactagcaacaactactttgtctaatcttccccaccaatccgtaa |
34222370 |
T |
|
| Q |
101 |
tttgtgtcgctacattattttcat |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34222369 |
tttgtgtcgctacattattttcat |
34222346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3013 times since January 2019
Visitors: 4805