View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0765_high_10 (Length: 299)

Name: NF0765_high_10
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0765_high_10
NF0765_high_10
[»] chr7 (1 HSPs)
chr7 (50-230)||(22986251-22986427)


Alignment Details
Target: chr7 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 50 - 230
Target Start/End: Complemental strand, 22986427 - 22986251
Alignment:
50 aacctgtgcaaatgacctgaatggtggtggaaccgcagctgaaggtggaggctgcaactacgctgaagaagagggagctgtcggggcagcaaattcagcc 149  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||| ||||||||||||||||| ||    
22986427 aacctgtgcaaatgacctaaatggtggtggaaccgcagctgaaggtggaggctgcacccacgctgcagaagagggagctatcggggcagcaaattcatcc 22986328  T
150 taccagtcaaaggacatggctgaaccgcgcgcagcagtgttataacggtggattatggccagaaaaatggtgatgatgatg 230  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||    
22986327 taccagtcaaaggacatggttgaaccgcgcgcagcagtgttataacggtgg----tggccagaaaaatggtgatgatgatg 22986251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University