View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0765_high_10 (Length: 299)
Name: NF0765_high_10
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0765_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 50 - 230
Target Start/End: Complemental strand, 22986427 - 22986251
Alignment:
| Q |
50 |
aacctgtgcaaatgacctgaatggtggtggaaccgcagctgaaggtggaggctgcaactacgctgaagaagagggagctgtcggggcagcaaattcagcc |
149 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||| ||||||||||||||||| || |
|
|
| T |
22986427 |
aacctgtgcaaatgacctaaatggtggtggaaccgcagctgaaggtggaggctgcacccacgctgcagaagagggagctatcggggcagcaaattcatcc |
22986328 |
T |
 |
| Q |
150 |
taccagtcaaaggacatggctgaaccgcgcgcagcagtgttataacggtggattatggccagaaaaatggtgatgatgatg |
230 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22986327 |
taccagtcaaaggacatggttgaaccgcgcgcagcagtgttataacggtgg----tggccagaaaaatggtgatgatgatg |
22986251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University