View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0765_high_8 (Length: 310)
Name: NF0765_high_8
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0765_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 48 - 303
Target Start/End: Complemental strand, 23905546 - 23905291
Alignment:
Q |
48 |
aatgaggtaagctcaattgcagtatattcattcgattgaaaatttattaacaatcttgcatttttataaagaactacaatctatttgcacaatgaggtgt |
147 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23905546 |
aatgaggtaagctcaattgtagtatattcattcgattgaaaatttattaacaatcttgcatttttataaagaactacaatctatttgcacaatgaggtgt |
23905447 |
T |
 |
Q |
148 |
tgtccctaacagaaagctgtgcactactcatttatgagtctttcaatatcttcattatcttacataattggtttgtgagggtctcgtattcatagttgtc |
247 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23905446 |
tgtccctaacagaaagctgtgcactactcatttatgagtctttcaatatcttcattatcttacataattggtttgtgagggtctcgtattcatagttgtc |
23905347 |
T |
 |
Q |
248 |
acaaaatggttttacatagttcccttattctttgttttgtgggttttcctttgctt |
303 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23905346 |
acaaaatggttttacatagttcccttattctttgttttgtgggttttcctttgctt |
23905291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2654 times since January 2019
Visitors: 4796