View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0765_low_10 (Length: 347)
Name: NF0765_low_10
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0765_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 8 - 336
Target Start/End: Complemental strand, 6722026 - 6721698
Alignment:
Q |
8 |
tagcaagatgttttgaggatattttttagaatgagatgtgtgccttattttggtgtggaacaatctattgtacacccaaaccggttatgtcggttttact |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
6722026 |
tagcaagatgttttgaggatattttttagaatgagatgtgtaccttattttggtgtggaacaatctattgtacacccaaagcggttatgtcggttttact |
6721927 |
T |
 |
Q |
108 |
catatggctcgatggtcggacgaccagttgatcatgtgaatggcttagatatgatttaatcttactatccagtgtatcacaactctttatcaatatttgt |
207 |
Q |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6721926 |
cttatggctcgatggtcggacgaccagttgatcatgtgaatggcttagatatgatctaatcttactatccagtgtatcacaactctttatcaatatttgt |
6721827 |
T |
 |
Q |
208 |
tgtccacaattgtagatgagtaccttattttacctaagatgggataatcaaatctggatcatgaagatcaaattggatcatcttcttccaatcactcttt |
307 |
Q |
|
|
|||| |||||||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
6721826 |
ggtccgcaattgtagatgagcaccttattgtgcctaagatgggataatcaaatctggatcatgaagatcaaattggatcatctctttccaatcactcttt |
6721727 |
T |
 |
Q |
308 |
ccttctcgctccttccacaatctttctct |
336 |
Q |
|
|
||||||||||||||||||||||| ||||| |
|
|
T |
6721726 |
ccttctcgctccttccacaatctctctct |
6721698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University