View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0765_low_14 (Length: 317)

Name: NF0765_low_14
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0765_low_14
NF0765_low_14
[»] chr3 (1 HSPs)
chr3 (96-317)||(45974761-45974982)


Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 96 - 317
Target Start/End: Original strand, 45974761 - 45974982
Alignment:
96 aatatctgctttctgcgactggtttatcgacaaaaaacgacactccggtcatcatactcaccacttccaccgccgcttgtcaacctccgatgacgatcac 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
45974761 aatatctgctttctgcgactggtttatcgacaaaaaacgacactccggtcatcttactcaccacttccaccgccgcttgtcaacctccgatgacgatcac 45974860  T
196 gactattttcattctcagccagagacagccgtcaatgataccgcaatcgaccggaatttcgaccgtcaagtttcacttccgaggctatccagcgacagta 295  Q
    |||| ||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||    
45974861 gacttttttcattctcagccagagacagccgtcaatgacaccgcaattgaccggaatttcgaccgtcaagtttcacttccgaggctatcgagcgacagta 45974960  T
296 gctatgcagggagtttgttttc 317  Q
    ||||||||||||||||||||||    
45974961 gctatgcagggagtttgttttc 45974982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University