View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0765_low_14 (Length: 317)
Name: NF0765_low_14
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0765_low_14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 96 - 317
Target Start/End: Original strand, 45974761 - 45974982
Alignment:
| Q |
96 |
aatatctgctttctgcgactggtttatcgacaaaaaacgacactccggtcatcatactcaccacttccaccgccgcttgtcaacctccgatgacgatcac |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45974761 |
aatatctgctttctgcgactggtttatcgacaaaaaacgacactccggtcatcttactcaccacttccaccgccgcttgtcaacctccgatgacgatcac |
45974860 |
T |
|
| Q |
196 |
gactattttcattctcagccagagacagccgtcaatgataccgcaatcgaccggaatttcgaccgtcaagtttcacttccgaggctatccagcgacagta |
295 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45974861 |
gacttttttcattctcagccagagacagccgtcaatgacaccgcaattgaccggaatttcgaccgtcaagtttcacttccgaggctatcgagcgacagta |
45974960 |
T |
|
| Q |
296 |
gctatgcagggagtttgttttc |
317 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45974961 |
gctatgcagggagtttgttttc |
45974982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4028 times since January 2019
Visitors: 4825