View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0765_low_2 (Length: 919)
Name: NF0765_low_2
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0765_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 7e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 7e-70
Query Start/End: Original strand, 95 - 257
Target Start/End: Original strand, 24941837 - 24941999
Alignment:
| Q |
95 |
aaatagaccttctgatgtctggacatccaccccagtctgaatcattctaaaagataaacttattgatggaggaaggatacatgtgcaggctgggatcaat |
194 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
24941837 |
aaatagaccttttgatgtctggacatccaccccagtctgaatcattgtaaaagataagcttattgatggaggaaggatacacgtgaaggctgggatcaat |
24941936 |
T |
 |
| Q |
195 |
aatgccctgaatatagtgaatgatgcgcttcaatgccgacatatgttgtatttttggattacg |
257 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24941937 |
aatgccctgaatatagtgaatgacgcgcttcaatgccgacatatgttgtgtttttggattacg |
24941999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 720 - 840
Target Start/End: Original strand, 24942002 - 24942119
Alignment:
| Q |
720 |
aggtgtttgtttgagtacgtatagagacttggatgagtcactatgtgagttttagaggaaagttacttcaaaaacgcatatgagcatattgacatatgtt |
819 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
24942002 |
aggtgtttgtttgag---gtatagagacttggatgtgtcactatgtgagttttagaggaaagttacttccaaaacgcatatgagcatattgatatatgtt |
24942098 |
T |
 |
| Q |
820 |
gttctattagttacatgttgc |
840 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24942099 |
gttctattagttacatgttgc |
24942119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University