View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0765_low_2 (Length: 919)

Name: NF0765_low_2
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0765_low_2
NF0765_low_2
[»] chr8 (2 HSPs)
chr8 (95-257)||(24941837-24941999)
chr8 (720-840)||(24942002-24942119)


Alignment Details
Target: chr8 (Bit Score: 135; Significance: 7e-70; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 135; E-Value: 7e-70
Query Start/End: Original strand, 95 - 257
Target Start/End: Original strand, 24941837 - 24941999
Alignment:
95 aaatagaccttctgatgtctggacatccaccccagtctgaatcattctaaaagataaacttattgatggaggaaggatacatgtgcaggctgggatcaat 194  Q
    ||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| ||| ||||||||||||||    
24941837 aaatagaccttttgatgtctggacatccaccccagtctgaatcattgtaaaagataagcttattgatggaggaaggatacacgtgaaggctgggatcaat 24941936  T
195 aatgccctgaatatagtgaatgatgcgcttcaatgccgacatatgttgtatttttggattacg 257  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||    
24941937 aatgccctgaatatagtgaatgacgcgcttcaatgccgacatatgttgtgtttttggattacg 24941999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 720 - 840
Target Start/End: Original strand, 24942002 - 24942119
Alignment:
720 aggtgtttgtttgagtacgtatagagacttggatgagtcactatgtgagttttagaggaaagttacttcaaaaacgcatatgagcatattgacatatgtt 819  Q
    |||||||||||||||   ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||    
24942002 aggtgtttgtttgag---gtatagagacttggatgtgtcactatgtgagttttagaggaaagttacttccaaaacgcatatgagcatattgatatatgtt 24942098  T
820 gttctattagttacatgttgc 840  Q
    |||||||||||||||||||||    
24942099 gttctattagttacatgttgc 24942119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University