View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0765_low_22 (Length: 286)

Name: NF0765_low_22
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0765_low_22
NF0765_low_22
[»] chr5 (1 HSPs)
chr5 (51-233)||(40591998-40592178)


Alignment Details
Target: chr5 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 51 - 233
Target Start/End: Original strand, 40591998 - 40592178
Alignment:
51 aaggtaacttagttgagagaatgattttatctctcctcaaatcttgtcaaatgtcatttatcctgatgcacatacttgtctaaaacgagaatcgttaatg 150  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||    
40591998 aaggtaacttagttgaga--atgattttatctctcctcaaatcttgtcatatgtcatttatcccgatgcacatacttgtctaaaacgagaatcgttaatg 40592095  T
151 atgtaattgacaaagtaaacttacatgacagttagcagtagcagctattgctagacgaagaaagttgctgaatgatgatgtcc 233  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
40592096 atgtaattgacaaagtaaacttacatgacagttagcagtagcagctattgctagacgaagaaagtttctgaatgatgatgtcc 40592178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University