View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0765_low_22 (Length: 286)
Name: NF0765_low_22
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0765_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 51 - 233
Target Start/End: Original strand, 40591998 - 40592178
Alignment:
| Q |
51 |
aaggtaacttagttgagagaatgattttatctctcctcaaatcttgtcaaatgtcatttatcctgatgcacatacttgtctaaaacgagaatcgttaatg |
150 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40591998 |
aaggtaacttagttgaga--atgattttatctctcctcaaatcttgtcatatgtcatttatcccgatgcacatacttgtctaaaacgagaatcgttaatg |
40592095 |
T |
 |
| Q |
151 |
atgtaattgacaaagtaaacttacatgacagttagcagtagcagctattgctagacgaagaaagttgctgaatgatgatgtcc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40592096 |
atgtaattgacaaagtaaacttacatgacagttagcagtagcagctattgctagacgaagaaagtttctgaatgatgatgtcc |
40592178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University