View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0765_low_24 (Length: 277)
Name: NF0765_low_24
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0765_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 46 - 238
Target Start/End: Complemental strand, 3717691 - 3717494
Alignment:
| Q |
46 |
gacatcatcaactatagctatacat-----catatgatgaaactttgctcaaagttcttgtcctctatccacaaactccatcagtgaaatccatggggaa |
140 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3717691 |
gacatcataaactatagctatacattacatcatatgatgaaactttgctcaaagttcttgtcctctatccacaaactccatcatcgaaatccatggggaa |
3717592 |
T |
 |
| Q |
141 |
taaattctcacaaaatctctgtgaatgccctggtatcccacgaaagaagcatatggtacaaactcatagtgaaaaatgagaacaccacactcacctct |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3717591 |
taaattctcacaaaatctcagtgaatgccctggtatcccacgaaagaagcatagagtaccaactcatagtgaaaaatgagaacaccacactcacctct |
3717494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University