View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0765_low_31 (Length: 251)
Name: NF0765_low_31
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0765_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 9 - 233
Target Start/End: Complemental strand, 12273894 - 12273671
Alignment:
Q |
9 |
caacaatatcttgaagcatatcataaaaattcaagcaatcatttgacacctaccagctgaagagtcccacttgcatggccagaagcacctgaagctataa |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12273894 |
caacaatatcttgaagcatatcataaaaattcaagcaatcatttgacacctaccagctgaagagtcccacttgcatggccagaagcacctgaagctataa |
12273795 |
T |
 |
Q |
109 |
tttgaacagttcttgctctagcaacaattgttggaaacaattccatccatttttgctataaaacatacaaggtaaagaaagnnnnnnnnncacaaaattc |
208 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
12273794 |
tttgaacagttcttgctctagcaacaattgttggaaacaattccatccatttttgctataaaacatacaaggtaaagaaag-aaaaaaaacacaaaattc |
12273696 |
T |
 |
Q |
209 |
ataagaaataaattaatagagaagg |
233 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
12273695 |
ataagaaataaattaatagagaagg |
12273671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University