View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0765_low_33 (Length: 244)
Name: NF0765_low_33
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0765_low_33 |
 |  |
|
[»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 25742647 - 25742873
Alignment:
Q |
17 |
atataccagctcatacactgcacagtcctagatatttcatcgttgtttattttgttctttcttgatcagtagaaaatgtggaacagaaagaatgttcaag |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||| |
|
|
T |
25742647 |
atataccagctcatacactgcacagtcctagatatttcatcgttgtttattttgtt-tttcttgatcagtagaaaatgtggaacagaatgaattttcaag |
25742745 |
T |
 |
Q |
117 |
aagaagcagttcagattatgaactcagatttcaaagacctgagtgaagctgctagtaaactcgctaatcatgccatcaaattagctggtgcaggcggctt |
216 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
25742746 |
aagaagcagttcagattatgaactcagatttcaaagacctgagtgaagctgctagtaaactcgctaatcatgccatcaaattagctggtgtaggcggctt |
25742845 |
T |
 |
Q |
217 |
tggagcttctttcttcggattctttgct |
244 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
25742846 |
tggagcttctttcttcggattctttgct |
25742873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 62 - 244
Target Start/End: Original strand, 25739131 - 25739310
Alignment:
Q |
62 |
tttattttgttctttcttgatcagtagaaaatgtggaacagaaagaatgttcaagaagaagcagttcagattatgaactcagatttcaaagacctgagtg |
161 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||| || |||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
25739131 |
tttattttgttctttcttgatcaatagaaaatgtggaacaaaatgaattttcaagaagaagcagttcaggttatgaactcagatttcaaagacctgagtg |
25739230 |
T |
 |
Q |
162 |
aagctgctagtaaactcgctaatcatgccatcaaattagctggtgcaggcggctttggagcttctttcttcggattctttgct |
244 |
Q |
|
|
||| |||||| | |||||||||||||||||||||||| |||||| | |||| |||| ||||||||| |||||||||||| |
|
|
T |
25739231 |
aagttgctagcagactcgctaatcatgccatcaaattcgctggtata---ggctggggaggttctttctttggattctttgct |
25739310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2861 times since January 2019
Visitors: 4801