View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0765_low_7 (Length: 378)
Name: NF0765_low_7
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0765_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 101 - 374
Target Start/End: Complemental strand, 10980470 - 10980195
Alignment:
| Q |
101 |
agtatttgctagaaaattcaaagggtggacactgtgatgaagaagccatgaaggaaattaaagaactatttttgatttagttatttgatgttatttatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10980470 |
agtatttgctagaaaattcaaagggtggacactgtgatgaagaagccatgaaggaaattaaagaactatttttgatttagttatttgatgttatttatca |
10980371 |
T |
 |
| Q |
201 |
tcattcaatgaaactataatacctatgcagcagcnnnnnnnncctaagtatttag---ttattttttaacagatcatagcggaaatttagaggcttatct |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10980370 |
tcattcaatgaaactataatacctatgcagcagc-tttttttcctaagtatttagttattattttttaacagatcatagcggaaatttagaggcttatct |
10980272 |
T |
 |
| Q |
298 |
ctattgagtagcaagtcaaactacgaagaaggtacgtaagtataatattattcttgaaatctcaaaggaatctaaag |
374 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10980271 |
ctattgagtagcaagtcaaactaagaagaaggtacgtaagtataatattattcttgaaatctcaaaggaatctaaag |
10980195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University