View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0765_low_9 (Length: 364)

Name: NF0765_low_9
Description: NF0765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0765_low_9
NF0765_low_9
[»] chr3 (2 HSPs)
chr3 (1-159)||(35189405-35189563)
chr3 (226-261)||(35189624-35189659)
[»] chr4 (1 HSPs)
chr4 (56-157)||(43970824-43970925)
[»] chr6 (1 HSPs)
chr6 (51-158)||(1663755-1663862)


Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 35189405 - 35189563
Alignment:
1 tcactcaaactctattgctactactggtggtaataacatggagcaaagagaagagtgggaaattgatccttctaacctcatcatcaagagtgtcttagct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35189405 tcactcaaactctattgctactactggtggtaataacatggagcaaagagaagagtgggaaattgatccttctaacctcatcatcaagagtgtcttagct 35189504  T
101 cgtggcactttcggtactgttcaccgtggtttctatgatggccaagatgttgctggtaa 159  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35189505 cgtggcactttcggtactgttcaccgtggtttctatgatggccaagatgttgctggtaa 35189563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 226 - 261
Target Start/End: Original strand, 35189624 - 35189659
Alignment:
226 acactcactcctcaaaccgactaaaccgccaaattc 261  Q
    ||||||||||||||||||||||||||||||||||||    
35189624 acactcactcctcaaaccgactaaaccgccaaattc 35189659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 56 - 157
Target Start/End: Original strand, 43970824 - 43970925
Alignment:
56 tgggaaattgatccttctaacctcatcatcaagagtgtcttagctcgtggcactttcggtactgttcaccgtggtttctatgatggccaagatgttgctg 155  Q
    |||||||||||||||||||| ||||||||||| |||||  | |||||||||||||| || |||||||| |||||| | ||||||   |||||||||||||    
43970824 tgggaaattgatccttctaaactcatcatcaaaagtgttattgctcgtggcacttttggcactgttcatcgtggtgtttatgatactcaagatgttgctg 43970923  T
156 gt 157  Q
    ||    
43970924 gt 43970925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 51 - 158
Target Start/End: Original strand, 1663755 - 1663862
Alignment:
51 aagagtgggaaattgatccttctaacctcatcatcaagagtgtcttagctcgtggcactttcggtactgttcaccgtggtttctatgatggccaagatgt 150  Q
    |||| ||||| |||||||||||||| || || ||||| | |||| | |||||||| ||||| ||||||||||| |||||| | |||||||||  ||||||    
1663755 aagaatgggagattgatccttctaaacttattatcaaaactgtcattgctcgtggtacttttggtactgttcatcgtggtgtttatgatggcatagatgt 1663854  T
151 tgctggta 158  Q
    ||||||||    
1663855 tgctggta 1663862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3252 times since January 2019
Visitors: 4808