View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_high_15 (Length: 374)
Name: NF0766_high_15
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0766_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 5027225 - 5027528
Alignment:
Q |
1 |
cagcttcaaattcttctcaacattccattctcttccattatccgccgcgttaaaaataatagtttctggcatccttcatggggtccaatcccgaaagata |
100 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5027225 |
cagcttcaaattcttctcaacattccagtctcttccattctccgccgcgttaaaaataatagtttctggcatccttcatggggtccaatcccgaaagata |
5027324 |
T |
 |
Q |
101 |
agctaaccgcggcgcagaggattttggactctgcgccgcagttagttccgatctttcggcattgttatatacctatgaatccgtttgttactgggaatcc |
200 |
Q |
|
|
||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5027325 |
agctaaccgcggcgcagaggattttggaccctgcaccgcagttagttccgatctttcggcattgttatatacctatgaatccgtttgttactgggaatcc |
5027424 |
T |
 |
Q |
201 |
ggttttttacgttgatcatggtggtgatgtgaaattggtgagttatgatattgtggggttttttagggatggagggtttttggatggggttgaagaggtg |
300 |
Q |
|
|
||| ||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5027425 |
ggtattttacgttgatcatagtggtgatgtgagattggtgggttatgatattgtggggttttttagggatggagggtttttggatggggttgaagaggtg |
5027524 |
T |
 |
Q |
301 |
gatg |
304 |
Q |
|
|
|||| |
|
|
T |
5027525 |
gatg |
5027528 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University