View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_high_30 (Length: 243)
Name: NF0766_high_30
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0766_high_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 29487688 - 29487475
Alignment:
| Q |
1 |
cttgaagagtagagagtcaaatcaaaaataaggcgaacaatcacacatcacgtgcacaattcaacgcatctgcatgcgaacacgaaactaaattatagaa |
100 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||| || |
|
|
| T |
29487688 |
cttgaagggtagagagtcaaatccaaaataaggcgaacaatcacacgtcacgtgcacaattcaacgcatcaacatacgaacacgaaactaaattataaaa |
29487589 |
T |
|
| Q |
101 |
aaagagtatcatcgtgacaaccgataaatcgtcccgtccaccacaactctctgcttcataacacccgaaaacccccagcaacatagcccctttcgagcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| || |
|
|
| T |
29487588 |
aaagagtatcatcgtgacaaccgataaatcgacccgtccaccacaactctctgcttcataacacccgaaaacacccagcaacatagaccctttcgagtca |
29487489 |
T |
|
| Q |
201 |
taacagttcgacca |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29487488 |
taacagttcgacca |
29487475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6028 times since January 2019
Visitors: 4868