View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_high_37 (Length: 222)
Name: NF0766_high_37
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0766_high_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 33 - 200
Target Start/End: Complemental strand, 3958373 - 3958206
Alignment:
Q |
33 |
aataatatcgatgttctaacttcgattcaactctcacatcaagaggactcttggcgtttgagttgggtgggtggtgtgcaatattatgttaagttggtgt |
132 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
3958373 |
aataatatcgatgttccaacttcgattcaactctcacatcaagaggactcttggcgtttgagttgggtgggtggtgtgcaatattatgttaagttggcgt |
3958274 |
T |
 |
Q |
133 |
atttgttattgtcagacaaatgtattcctaatccatctcattatgtggtcgagaatgagggaattcgt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3958273 |
atttgttattgtcagacaaatgtattcctaatccatctcattatgtggtcgagaatgagggaattcgt |
3958206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University