View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_high_38 (Length: 219)
Name: NF0766_high_38
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0766_high_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 138 - 198
Target Start/End: Original strand, 29487777 - 29487837
Alignment:
| Q |
138 |
tatttgtttcttggttacaaaatttatggttgggattaaattttctaggaatatgatgatg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
29487777 |
tatttgtttcttggttacaaaatttatggtcgggattaaattttttaggaatatgatgatg |
29487837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 49
Target Start/End: Original strand, 29487643 - 29487688
Alignment:
| Q |
4 |
gtgtgattgttcgccttattttagatttgactctctactcttcaag |
49 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
29487643 |
gtgtgattgttcgccttattttggatttgactctctacccttcaag |
29487688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6027 times since January 2019
Visitors: 4868