View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0766_high_40 (Length: 203)

Name: NF0766_high_40
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0766_high_40
NF0766_high_40
[»] chr4 (2 HSPs)
chr4 (1-65)||(7707185-7707249)
chr4 (63-111)||(7706286-7706334)


Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 7707249 - 7707185
Alignment:
1 gattgtagaatatgcaggattaattgtctaaatctcattgttattatgtatatattaataattta 65  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
7707249 gattgtagaatatgcaggattaattgtctaaatctcattgttattatgtatatatgaataattta 7707185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 63 - 111
Target Start/End: Complemental strand, 7706334 - 7706286
Alignment:
63 ttaattttctagcatttttatactgttgtttaagttagcattacgtgat 111  Q
    ||||||| ||| ||||||||| |||||||||||||||||||||||||||    
7706334 ttaatttactaccatttttatgctgttgtttaagttagcattacgtgat 7706286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University