View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_high_40 (Length: 203)
Name: NF0766_high_40
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0766_high_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 7707249 - 7707185
Alignment:
| Q |
1 |
gattgtagaatatgcaggattaattgtctaaatctcattgttattatgtatatattaataattta |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7707249 |
gattgtagaatatgcaggattaattgtctaaatctcattgttattatgtatatatgaataattta |
7707185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 63 - 111
Target Start/End: Complemental strand, 7706334 - 7706286
Alignment:
| Q |
63 |
ttaattttctagcatttttatactgttgtttaagttagcattacgtgat |
111 |
Q |
| |
|
||||||| ||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7706334 |
ttaatttactaccatttttatgctgttgtttaagttagcattacgtgat |
7706286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6023 times since January 2019
Visitors: 4868