View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_low_14 (Length: 440)
Name: NF0766_low_14
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0766_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 101 - 430
Target Start/End: Complemental strand, 8453000 - 8452677
Alignment:
| Q |
101 |
ccttttcctctataaagtaatattatctgctcttcattcttcttgtaatgtcttaaatattatggatttatcagactttaccaactgttgccttttctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8453000 |
ccttttcctctataaagtaatattatctgctcttcattcttcttgtaatgtcttaaatat---ggatttatcagactttaccaactgttgccttttctct |
8452904 |
T |
 |
| Q |
201 |
tatcatgctcctcagtatccaatatccatccatccttggcctttgattaattatttaacttgaacttgatcttggtgcaagccggttacaagttcaagat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8452903 |
tatcatgctcctcagtatccaatatccatccatccttggcctttgattaattatttaacttgaacttgatcttggtgcaagccggttacaagttcaagat |
8452804 |
T |
 |
| Q |
301 |
agggataaaggtttgaatttttattacatttaatttgatgatcattatgctgtatttcctattgttccttagtttaca-ttttnnnnnnntgataattta |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
8452803 |
agggataaaggtttgaatttttattacatttaatttgatgatcattatgttgtatttcctattgttccttagtttacatttttccccccctgataat--- |
8452707 |
T |
 |
| Q |
400 |
attaatatccccctcttcatccttgcctatg |
430 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8452706 |
-ttaatatccccctcttcatccttgcctatg |
8452677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University