View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_low_21 (Length: 408)
Name: NF0766_low_21
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0766_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 80 - 313
Target Start/End: Complemental strand, 29105039 - 29104806
Alignment:
Q |
80 |
gaagccattcagtatattcaccacgttcaccaacttcaaagagccatgcactcgttactcgagctcgaaccatcgtctccgaaactcatccatgcacaaa |
179 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
29105039 |
gaagccattcagtatattcaccacgttaaccaacttcaaagagccatgcactcgttactcgagctcgaaccatcgtctccgaaactcatccatgctcaaa |
29104940 |
T |
 |
Q |
180 |
acctaatgcaaatcgctatgaagaggctccaaaaagagttttaccagatattaaccatgaaccaggcttgcttagacgctgaatccttctctgtcggatc |
279 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
29104939 |
acctaatgcaaatcgctatgaagaggctccaaaaagagttttaccagatattaaccatgaaccaggcctgcttagacgctgaatccttctctgtcggatc |
29104840 |
T |
 |
Q |
280 |
ctccagaacttctttctgttcttttgatggagga |
313 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
29104839 |
ctccagaacttctttctgttcttttgatggagga |
29104806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 79 - 309
Target Start/End: Complemental strand, 29090779 - 29090549
Alignment:
Q |
79 |
tgaagccattcagtatattcaccacgttcaccaacttcaaagagccatgcactcgttactcgagctcgaaccatcgtctccgaaactcatccatgcacaa |
178 |
Q |
|
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
T |
29090779 |
tgaagccattcagtacattcaccacgttaaccaacttcaaagagccatgcactcgttactcgagctcgaaccatcgtctccagaactcatccacgcacaa |
29090680 |
T |
 |
Q |
179 |
aacctaatgcaaatcgctatgaagaggctccaaaaagagttttaccagatattaaccatgaaccaggcttgcttagacgctgaatccttctctgtcggat |
278 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||| || |||||||| ||||||||||||||||| | ||||||| ||||||||||||| || ||| |
|
|
T |
29090679 |
aacctaatgcaaattgctatgaagaggctccaaaaagaattctaccagatcttaaccatgaaccaggcatacttagactctgaatccttctccatcagat |
29090580 |
T |
 |
Q |
279 |
cctccagaacttctttctgttcttttgatgg |
309 |
Q |
|
|
||| || ||||||||| ||||||||||||| |
|
|
T |
29090579 |
cctttagcacttctttcggttcttttgatgg |
29090549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5781 times since January 2019
Visitors: 4859