View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_low_31 (Length: 365)
Name: NF0766_low_31
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0766_low_31 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 26 - 365
Target Start/End: Original strand, 6723114 - 6723453
Alignment:
| Q |
26 |
atcaagttggagttgtttaatagagtaggtccagtggttgagatgaaggaatattggttgttaaaaatagaccagtcttgcctaaagaaaatgtgttgtt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
6723114 |
atcaagttggagttgtttaatagagtaggtccagtggttgagatgaaggaatattggttgttaaaaatagaccaggcttgcctaaagaaaatgtattgtt |
6723213 |
T |
|
| Q |
126 |
tatgattaattcttttcatgtatgcaaaaggactcagctagcgagatgtgtaatctgcttaagttttgatatggagattatttatatttcaattatggag |
225 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
6723214 |
tatgattaattcctttcatgtatgcaaaagttctcagctagcgagatgtataatctgcttaagttttgatatggagattatttgtatttcacttatggag |
6723313 |
T |
|
| Q |
226 |
ttaaacatagttagattaatggtcttgaaagtcattaagcaaaattttatccaannnnnnnctcaacatttaatggagtgtaatatctgttggagattga |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6723314 |
ttaaacatagttagattaatggtcttgaaagtcattaagcaaaattttatccaatctttttctcaacatttaatggagtgtaatatctgttggagattga |
6723413 |
T |
|
| Q |
326 |
tatttttgctgtttttgttcattattatctactgttgttt |
365 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6723414 |
tatttttgctatttttgttcattattatctactgttgttt |
6723453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5027 times since January 2019
Visitors: 4845