View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_low_33 (Length: 340)
Name: NF0766_low_33
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0766_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 8e-52; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 138 - 308
Target Start/End: Complemental strand, 9995242 - 9995075
Alignment:
Q |
138 |
gtggttcttacaccctcgagggttgttatgtgttgttgtattaccttatggatgnnnnnnncccttttgggtagtaaggccttttgtccctccactcttg |
237 |
Q |
|
|
|||||||||||| |||||||||||||||||| ||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
T |
9995242 |
gtggttcttacagcctcgagggttgttatgtattgttgtattaccctatggatgtttttttcccttttgg---gtaaggccttttgtccctccactcttg |
9995146 |
T |
 |
Q |
238 |
tgtacctttgttttttcttgtttatttaggtgctacagatccgtttgcaccagtttgtctaaaagaatact |
308 |
Q |
|
|
|||||||||||||||| | ||||||||||||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
T |
9995145 |
tgtacctttgttttttatagtttatttaggtgctgcagatccatttgcaccggtttgtctaaaagaatact |
9995075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 4 - 51
Target Start/End: Complemental strand, 9995376 - 9995329
Alignment:
Q |
4 |
atgtcgaagaatattttgacgtttccttaggtaattccgcaggattgc |
51 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9995376 |
atgtcgaataatattttgacgtttccttaggtaattccgcaggattgc |
9995329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 5 - 55
Target Start/End: Complemental strand, 10006263 - 10006213
Alignment:
Q |
5 |
tgtcgaagaatattttgacgtttccttaggtaattccgcaggattgctgcg |
55 |
Q |
|
|
||||||| ||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
T |
10006263 |
tgtcgaataatatttcgacgtttccttaggtaattccgcaggaatgctgcg |
10006213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 138 - 191
Target Start/End: Original strand, 3587178 - 3587231
Alignment:
Q |
138 |
gtggttcttacaccctcgagggttgttatgtgttgttgtattaccttatggatg |
191 |
Q |
|
|
|||||||||| |||||| ||||||| ||||| | |||||||||||||||||||| |
|
|
T |
3587178 |
gtggttcttataccctcaagggttgctatgtatcgttgtattaccttatggatg |
3587231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University