View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_low_36 (Length: 323)
Name: NF0766_low_36
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0766_low_36 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 20480765 - 20480914
Alignment:
| Q |
1 |
ataatacccagttttagttgttcgttgattatgataccttgcaaaattaaatttgatgtatttcgtttaagtaaggtaccttttataaacagaaatgata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20480765 |
ataatacccagttttagttgttcgttgattatgataccttgcaaaattaaatttgatgtatttcgtttaagtaaggtaccttttataaacaggaatgata |
20480864 |
T |
|
| Q |
101 |
actgaacacagttttttcgacacaataacgacattgtatgaaaatcagta |
150 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
20480865 |
actgaacaaagttttttcaacacaataacgacaccgtatgaaaatcagta |
20480914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 87 - 127
Target Start/End: Complemental strand, 10137213 - 10137173
Alignment:
| Q |
87 |
aaacagaaatgataactgaacacagttttttcgacacaata |
127 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
10137213 |
aaacagaaatgataactgaacacatttttttaaacacaata |
10137173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 91 - 127
Target Start/End: Complemental strand, 50470561 - 50470525
Alignment:
| Q |
91 |
agaaatgataactgaacacagttttttcgacacaata |
127 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
50470561 |
agaaatgataactgaacacacttttttagacacaata |
50470525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5798 times since January 2019
Visitors: 4859