View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_low_37 (Length: 317)
Name: NF0766_low_37
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0766_low_37 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 97 - 317
Target Start/End: Original strand, 19151883 - 19152103
Alignment:
Q |
97 |
caactatgcatgcccaccccctaatcacatggagaccacacaacataaaaggaaatttcaatcctatagtaagtttccttttaggaccacaatgtaatga |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19151883 |
caactatgcatgcccaccccctaatcacatggagaccacacaacataaaaggaaatttcaatcctatagtaagtttccttttaggaccacaatgtaatga |
19151982 |
T |
 |
Q |
197 |
ttcctttatgcccaccccctaatcatgctgtctcgaatttaccagtataatcacgttaaattttcttgacaatttctaaccaataacatttaatgaggta |
296 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19151983 |
ttcctttatgcccaccccctaatcatgctgtctcgaatttaccagtataatcacgttaaattttcttgacaatttctaaccaataacatttaatgaggta |
19152082 |
T |
 |
Q |
297 |
gagcattccaatgggagtttg |
317 |
Q |
|
|
||||||| ||||||||||||| |
|
|
T |
19152083 |
gagcatttcaatgggagtttg |
19152103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University