View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_low_40 (Length: 295)
Name: NF0766_low_40
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0766_low_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 107 - 288
Target Start/End: Original strand, 16662656 - 16662838
Alignment:
Q |
107 |
ttcctgccattcatattattagatggaaccaccattttcatccttgagnnnnnnnnnnat-gggaccaatattattttcacattgattaatcagtttcat |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16662656 |
ttcctgccattcatattattagatggaaccaccattttcatccttgagttttttttttttagggaccaatattattttcacattgattaatcagtttcat |
16662755 |
T |
 |
Q |
206 |
cgaaggaacatgttctaagaagagaggagaaagatattaggttaaaaacttttttattttaatctacttgtcagttcatctca |
288 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16662756 |
cgaaggaacatgttctaagaagagaggagaaagatattaggttaaaaacttttttattttaatctacttgtcagttcatctca |
16662838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5873 times since January 2019
Visitors: 4860